Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST198642
Clone ID OST198642
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST198642
Sequence
GACGTCTGGGGAGCTCCTGCATTAAGTCAGACTGAGGAGACCTCCATTTTAGAAGAATATAGTATCAATTGGACTCAGAA
ACTGGGAGCCGGAATTAGTGGTCCAGTTAGAGTCTGTGTGAAGAAATCCACTCAAGAACGGTTTGCACTGAAAATTCTTC
TTGATCGTCCAAAAGCTAGAAATGAGGTGCGCCCTGCACATGATGTGTGCCACACACCCCAACATAGTTCAGATTATTGA
AGTGTTTGCTAACAGTGTACAGTTCCCTCATGAGTCCAGCCCCAGGGCTCGACTCTTAATTGTAATGGAGATGATGGAAG
GGGGAGAGCTATTTCACAGAATCAGCCAGCACCGGCACTTTACAGAGAAGCAAGCCAGCCAAGTAACAAAGCAGATAGCC
CTGGCTCTACAGCACTGTCACTTGCTAAACATTGCGCACAGAGACCTCAAGCCTGAAAATCTGCTTTTCAAGGATAACTC
TCTGGACGCCCCTGTGAAATTATGTGACTTTGGGTTTGCTAAAGTTGACCAAGGTGATTTGATGACACCCCAGTT
Sequence Type mRNA
Unitrap ID UNI24993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121984369..121990586 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029454 (Mapkapk5) NM_010765 MAP kinase-activated protein kinase 5 Gene [Source:MGI (curated);Acc:Mapkapk5-005]

 
Come back to gene ENSMUSG00000029454


For any suggestions or comments, please send an email to unitrap@crg.es