Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST198495
Clone ID OST198495
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST198495
Sequence
GACTGAGACTAATGTCTCAGAAGAATTTGAGGAGATCAAGAAGTCCAATCAAGCTGCAGCCAGAAAGCTGTTGGAGGAGC
ACTGCAGCTCTTCCTCTGAAGAAGAAGGGGATGAAGACTTGGAAGGAAAACAGGGGAAAATTGTTGCTAATACATTCACA
ACATACACCTACTCACACAGATGGAGATATACATGAATTAGAGCGAACAAAACAGTATCTGAATGAGGCTTTCCAAGCAG
GGGCTATGACGTGCCTAATTTGTATTGCTTNAGNGAAGAGAAACCAGGCAGTTTGGAGCTGTTCAGGATGTTTCTGTATA
TTCCATATGCCCTGTATTCAGAAGTGGGCTAAAGACAGNCAGTTTNTTGTGTCTTCTGTGACAGACGATGATNTTTGGAA
AGAAAGATTATCCCTGGCCATGGTAACTTTTTTCCTAGTTGATTGGATTTTAAGNTGTAGAATAAATTAATAAAGGGGGA
ACCTCATATATCA
Sequence Type mRNA
Unitrap ID UNI25000

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 72941460..72947583 191
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072889 (Nfxl1) NM_133921 nuclear transcription factor, X-box binding-like 1 Gene [Source:MGI (curated);Acc:Nfxl1-001]

 
Come back to gene ENSMUSG00000072889


For any suggestions or comments, please send an email to unitrap@crg.es