Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST198301
Clone ID OST198301
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST198301
Sequence
ACTGAGGGACTTGCCATGAGGTGTTGAAGCCTTGTTTCACTGAGTTGGAGAGACTGGACCTAAATGGCGCAGCATGACTT
TGCTCCAGCCTGGCTTAATTTTCCTACTCCTCCATCATCAACAAAGTCATCATTGAATTTTGAGAAGCACTCTGAAAATT
TTTCATGGACAGAAAATCGTTATGATGTGAGTCGTCGACGACACAATTCTTCAGATGGCTTTGATTCTGGTATTGGACGT
CCTAATGGAGGTAATTTTGGGAGGAAAGAGAAAAATGGATGGCGTACGCATGGCAGAAATGGTACAGAAAACATAAATCA
TCGTGGGGGATACCATGGNGGAAATTCCCGTTCTCGTAGCAGTATTTTCCATTCTGGAAAAAGCCAAGGACTACATGAAA
ACAGCATCCCTGACAATGAAACTGGGAGGAANGAAGACAAAAGAGANCGCAGACNGTTTGAGGCTGAGGATTTTCCATCT
TTAAATCCTGAATATGAGAGAGAACCAAAGTCAGAATAAATCTTTTAGCTGCGGGTGTTTGGGGGC
Sequence Type mRNA
Unitrap ID UNI699

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 112239140..112257180 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032745 (Gpbp1) NM_028487 GC-rich promoter binding protein 1 Gene [Source:MGI (curated);Acc:Gpbp1-002]

 
Come back to gene ENSMUSG00000032745


For any suggestions or comments, please send an email to unitrap@crg.es