Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSA056
Clone ID CSA056
Vector pGT0Lxf
Project baygenomics

Sequence tag CSA056
Sequence
GGCCTGCCTCCACCTCTGCCTGCCCCTGTGCCCATCACTGTGCCTCCAGCCGCACCGACTGCTGTGGCCCAGCCGATGCC
CA
Sequence Type mRNA
Unitrap ID UNI5525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26058430..26058511 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005442 (Cic) NP_082158 capicua homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1918972]

 
Come back to gene ENSMUSG00000005442


For any suggestions or comments, please send an email to unitrap@crg.es