Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSA077
Clone ID CSA077
Vector pGT0Lxf
Project baygenomics

Sequence tag CSA077
Sequence
GGGAAGTACAATGCCATGGTGCTGGAACTCCTTGGCCCTTGTTTGGAAGACTTGTTTGACCTCTGTGACCGAACGTTTAC
TTTGAAGACGGTGTTAA
Sequence Type mRNA
Unitrap ID UNI6436

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65847240..65847336 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032384 (Csnk1g1) NM_173185 casein kinase 1, gamma 1 Gene [Source:MGI (curated);Acc:Csnk1g1-001]

 
Come back to gene ENSMUSG00000032384


For any suggestions or comments, please send an email to unitrap@crg.es