Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSA082
Clone ID CSA082
Vector pGT0Lxf
Project baygenomics

Sequence tag CSA082
Sequence
TAGTGAACAAGGAGGCCTGGAGTTCACCACCTGTGGCTGTGCCTGTCCCTCCCCCTGACGATCTACTCCAGAGTCCACCT
GCTGTTTCTACACCTCCACCTCTGCCCAAGCCTGCCTTAGCTCAACCCCAAGAATCCTCTCCTCCAAGCAGCCCCCAGCT
AACTACCCCCACTCCTGTCCTTGGCAGCACTCAAGTCTCAGAGGTGGCATGCCAGACATCTGAGATTGCAGTGAGTGGTA
GCCCTGGAACTGAGAACAAGGACAGTGGTGAAGTCAGCTCACTCCCACTGGGCCTGACAGCACTGGACACTCGGCCTCTG
CAGTCCTCTGCACTGCTGGATAGTAGTAGCAGCAGCAGCAGCAGCAGCAGTAGCAGCAGCAGCAGTTCATCTGGACCCAA
CCCTTCTACCTCCTTTGAGCCCATCAAAGCAGACCCCACAGGCGTTCTGGATCTCCCCAAAGAGCTGTCAGAAATCTTCG
AC
Sequence Type mRNA
Unitrap ID UNI6438

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107824286..107828122 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014859 (E2f4) NM_148952 E2F transcription factor 4 Gene [Source:MGI Symbol;Acc:MGI:103012]

 
Come back to gene ENSMUSG00000014859


For any suggestions or comments, please send an email to unitrap@crg.es