Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST197971
Clone ID OST197971
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST197971
Sequence
GAACTGAGGTGAGCCAAGAGAAGGGTAACTGCTCTCTACAAAGAAACCCGACCCCCTGCATCATCCCTCAAGAACAAGAG
AACATCTTCCACACCATATTTGCTTTCTTCTCCAAGTCTGGAAGAAAAGTGTTGGACTGTGAAAAGCCAGGGAGCTTCTG
CCTAACGTTGCACTGCAACCTTAGTGCTCTTCCGAAAGAGGAGAGCCGCACCATCAACCTATACATGCTACTGAACACAG
AGATACTNGAAGAAGGACAGCTCCTCTGTCATCCAGTTCATGGCTCGAGCCAAGGTGAAGGTGGAGCCTGCCCTGAGAGT
GGTGGAGATAGCTAACGGGAACCCAGAAGAGACTCTGGTGGTCTTCGAGGCCTTGCACAATCTGGAACCCCGTGGCTACG
TTGTGGGGTGGATCATCGCCATCAGTTTGCTGGTGGGGATCCTCATTTTTCTGCTGCTGGCTGTGCTCCTGTGGAAGATG
GGCTTCTTCCGCAGAAGGTACAAAGAGATCATTGAAGCTGAGAAAAACCGGAAAGAGAATGAAGATGGTTG
Sequence Type mRNA
Unitrap ID UNI25019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 118778407..118806425 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039115 (Itga9) NM_133721 integrin alpha 9 Gene [Source:MGI Symbol;Acc:MGI:104756]

 
Come back to gene ENSMUSG00000039115


For any suggestions or comments, please send an email to unitrap@crg.es