Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSA100
Clone ID CSA100
Vector pGT0Lxf
Project baygenomics

Sequence tag CSA100
Sequence
GAGCAACAGCAGACCCTGGTGACTGCCCCCAAGCACAGCCAGATGAAAGCCCCGCTGTTGGACTTCTCCGTCTTGAAAGA
GAAAAGCTTCATTTGTTACGCTTTGTTCGGCCTCTTCGCCACCCTGGGCTTCTTTGCGCCTTCCCTCTACATCATTCCTT
TGGGTATCAGTCTAGGCATTGACCCTGACCGCGCTGCGTTTTTGCTGTCGACGATGGCCATTGCGGAAGTGTTCGGAAGG
ATCGGGGCTGGGTTTGTCCTCAACAGGGAGCCCATTCGCAAGATCTACATCGAACTCATCTGCGTCATTTTACTGACGGC
GTCTCTGTTCGCCTTCACTTTCGCTACCGAGTTCTGGGGCCTCATGCTGTGTAGCGTGTTCTTTGGCAGCATGGTTGGGA
CCATAGGAGGGACCCACATCCCGATGTTGGCAGAGGATGACGTCGTTGGGATCGAGAAGATGTCAATCTGCAGCTGGAGT
CTATGTCTT
Sequence Type mRNA
Unitrap ID UNI6444

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 109316218..109316705 485
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041920 (Slc16a6) NM_001029842 solute carrier family 16 (monocarboxylic acid transporters), member 6 Gene [Source:MGI (curated);Acc:Slc16a6-001]

 
Come back to gene ENSMUSG00000041920


For any suggestions or comments, please send an email to unitrap@crg.es