Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST197801
Clone ID OST197801
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST197801
Sequence
GACTGAGTGAAAGGTAAAGAGCAAGNANAGACCTTAGCATGTCAAGTCCACTAAAGCTTCAGTAGCCGTACATTCCCCAC
AAAAAAGCACTAAAAATCATGCCTTGCTGGAGGCTGCAGGACCAAGTCATGTTGCGATCAATGCCATTTCTGCCAACATG
GACTCCTTTTCAAGTAGCAGGACAGCAACGCTTAAGAAACAGCCAAGCCACATGGAGGCTGCTCATTTTGGAAAAAAGAA
AAA
Sequence Type mRNA
Unitrap ID UNI25025

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 61428427..61736333 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047804 (Akap10) NM_019921 A kinase (PRKA) anchor protein 10 Gene [Source:MGI (curated);Acc:Akap10-001]

 
Come back to gene ENSMUSG00000047804


For any suggestions or comments, please send an email to unitrap@crg.es