Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSA107
Clone ID CSA107
Vector pGT0Lxf
Project baygenomics

Sequence tag CSA107
Sequence
GAGGTCACCAGGAGGCGGGGCCTGTTCAGCAAGTCCTTGGAGCTGCATAGCCTCCTGGAGACGTCCATGAAGTGGAGCGA
CGAGGGGATCTTCCTGCTGGCCTCGCAGCCTGTGGACAAATGCCAGTCCCAGGATGGCGCAGAGGCGGCCCTCCAGGAGA
TTGAGAAGTTTGTGGAGACCTGGTGCAGTAAAATAAGATTCAGGAGTTCAATGAGATTTACAAGGAATACGAATGCATCC
TCAACCAGGACCTTCTGGAACACGTGCAAAAAGTCTTTCAGAAGCAAGAAAGCACGGAGGAGATGTTCCACCGCAGGCAA
GCCAGCCTGAAGAA
Sequence Type mRNA
Unitrap ID UNI6446

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 13001411..13002714 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031442 (Mcf2l) NM_178076 mcf.2 transforming sequence-like Gene [Source:MGI (curated);Acc:Mcf2l-009]

 
Come back to gene ENSMUSG00000031442


For any suggestions or comments, please send an email to unitrap@crg.es