Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSA119
Clone ID CSA119
Vector pGT0Lxf
Project baygenomics

Sequence tag CSA119
Sequence
GTGCTCCCTCCGCCGCCGCGCAACGGTTTCTGTCAGGATGAATTGGCAGAGCTTGATCCAGGCACTAATGGAGAGACTGA
CAGTTTAACACTTGGCCAAGGCCATATACCTGTTTCCGTCCCAGATGATCGAGCTGAACAACGAACCTGTCTCATCTGTG
GGGACCGCGCTACGGGCTTGCACTATGGGATCATCTCCTGCGAGGGCTGCAAGGGGTTTTTCAAGAGGAGCATTTGCAAC
AAACGGGTGTATCGGTGCAGTCGTGACAAGAACTGTGTCATGTCCCGGAAGCAGAGGAACAGATGTCAGTACTGCCGCCT
GCTCAAGTGTCTCCAGATGGG
Sequence Type mRNA
Unitrap ID UNI6449

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38615721..38781660 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063972 (Nr6a1) NM_010264 nuclear receptor subfamily 6, group A, member 1 Gene [Source:MGI (curated);Acc:Nr6a1-001]

 
Come back to gene ENSMUSG00000063972


For any suggestions or comments, please send an email to unitrap@crg.es