Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST197641
Clone ID OST197641
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST197641
Sequence
CTTGGTGGTGGGCTTGGTCCTATACATCTCCAGCATCAACGACGAGGTCNTGAACAGGCCCAGCAGCTCTGAGCAGTACT
TTCACTATCGCTACGGGTGGTCCTTTGCCTTCGCTGCTTCCTCTTTTCTTCTCAAAGAGGGGGCCGGAGTCATGTCCGTG
TACTTGTTCACCAAGCGCTACGCGGAGGAAGAGATGTATCGCCCGCACCCGGCCTTCTACCGACCGCGTCTCAGCGACTG
CTCCGACTACTCCGGCCAGTTTCTGCAGCCCGAGGCGTGGCGTCGAGGCCGCAGCCCTTCCGACATCTCTAGCGACGTCT
CCATTCAGATGACGCAAAATTACCCCCCGGCCATCAAGTACCCGGACCATCTCCACATCTCCACTTCGCCGTGCTGAGGC
TGGAGTCCCTCCCTTTCCTCTTTCTCCCTGCCCTCTCCCGNGCCTCACCCATGAAGCCCCAATTCCTTAAGGAACTCTA
Sequence Type mRNA
Unitrap ID UNI12914

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3365543..3366619 338
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069806 (Cacng7) NM_133189 calcium channel, voltage-dependent, gamma subunit 7 Gene [Source:MGI Symbol;Acc:MGI:1932374]

 
Come back to gene ENSMUSG00000069806


For any suggestions or comments, please send an email to unitrap@crg.es