Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST197635
Clone ID OST197635
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST197635
Sequence
GGCCTATGTGCTCATCAAGTTTGCCNACTCACCTCGGCCTGACCTCTGGGTGCTGGAGCGGTCCACAGACTTCGGTCACA
CTTATCAGCCGTGGCAGTTCTTTGCCTACCAGAAGAGGACACCAGATCTNACTNTAGATGGTTGCNAGCCNCCNTGTNNG
TTTCCTNNGANTTGAACCTCNAGACTCTNTGNNAAGAACNGCCAGTGCCTTATCTTAACCTCTGAGCTATCTCCTCTAGC
CCCTAGCCTAGGGTTTTGCTGTCCTGTTTGATAACCCCTGCTGGTCAGTAGAACGTGGGGCAGCAATCCTGTGTTTCGGA
GTGTGTAGGCAACACAAGGATGCTAGGNTGGGGCCCAGGATGGGAGTCTGTATCNTGGCATCTGTTACTCTACCTTCTTA
CCCGTTTCCTGCAGCCTCCAAGAGGGATTGTTTGGAGCGGNTTGGACCTCCGNACTCTAGAGCGCATCACGCATGAC
Sequence Type mRNA
Unitrap ID UNI16308

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 179941949..179943065 248
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015647 (Lama5) NM_001081171 laminin, alpha 5 Gene [Source:MGI (curated);Acc:Lama5-001]

 
Come back to gene ENSMUSG00000015647


For any suggestions or comments, please send an email to unitrap@crg.es