Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST197616
Clone ID OST197616
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST197616
Sequence
GCACCCCAATCAACCGGATTCCCATCATGGCCAAGCAGATCCTGGACCTGTACATGCTGTATAAACTGGTCACAGAGAAA
GGAGGCCTGGTGGAGATCATCAACAAGAAAATCTGGAGGGAGATCACCAAAGGCCTGAACCTGCCCACCTCCATCACCAG
CGCTGCCTTCACCCTCAGGACTCAGTACATGAAGTATCTATATGCCTATGAGTGTGAGAAGAAAGCCTTGAGCTCCCCAG
CTGAACTACAGGCAGCCATCGATGGCAACCGTAGGGAAGGTCGGAGGCCCAGCTACAGCTCCTCGCTCTTTGGCTATTCT
CCTGCTGCCGCCGCTGCTGCTGCTGCTGCCGCCGCCGCCGCTGCTGCTAGTGCTGCCTCTGCTGGGACCCCCGCCCTTCT
CTCGTCCCCCAA
Sequence Type mRNA
Unitrap ID UNI17525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57644368..57646032 228
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004661 (Arid3b) NM_019689 AT rich interactive domain 3B (BRIGHT-like) Gene [Source:MGI Symbol;Acc:MGI:1930768]

 
Come back to gene ENSMUSG00000004661


For any suggestions or comments, please send an email to unitrap@crg.es