Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST197560
Clone ID OST197560
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST197560
Sequence
GCAACACTGCATTGCATGATTGTGCAGAGTCTGGAAGTTTGGACATCATGAAGATGCTGCTTATGTATTGTGCCAAGATG
GAGAAAGATGGCTACGGAATGACTCCTCTTCTCTCAGCAAGTGTGACTGGTCACACTAAAATTGTGGATTTTCTTACGCA
CCATGCCCAGACAAGCAAGACAGAACGTATTAATGCTCTAGAGCTTCTGGGAGCTACGTTTGTAGATAAAAAAAGAGATT
TAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI5957

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 46665802..46666043 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033319 (Fem1c) NM_173423 fem-1 homolog c (C.elegans) Gene [Source:MGI Symbol;Acc:MGI:2444737]

 
Come back to gene ENSMUSG00000033319


For any suggestions or comments, please send an email to unitrap@crg.es