Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST197539
Clone ID OST197539
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST197539
Sequence
GACGTCTGGGGAGCTCCTGCATTAAGTCAGACTGAGGGCTGTGGTGGAGGCTGTGCATCGGCTAGATCTCATCCTTTGCA
ACAAAGCTGCTTATCAGGAAGTGTTCAAACCAGAGAACGTTAGCCTGAGGAACAAGCTACGAGAGCTCTGTGTGAAGCTT
ATGTTCTTGCATCCAGTAGACTATGGGAGGAAGGCCTGAGGAACTTGCTGTGGAGAAAGGTATACTATGAAGTTATCCAA
CTTATCAAGACTAACAAAAAGCACATCCACAGTCGGAGCACCTTGGAATGTGCCTACAGGACTCATCTGGTCGCTGGCAT
TGGCTTCTACCAGCATCTCCTTCTCTATATCCAGTCCCACTACCAGCTGGAACTACAGTGCTGCATCGACTGGACTCACG
TCACCGATCCCCTCATGGGATTCAAGAAGCCAGTATCTGCTTCAGGAAAGGAGATGGATTGGGCACAAATGGCTTGCCAC
CGATGCCTGGNGGTACCTGGGGGATCTGTGTAAGAGNCTGTACCTTTTATTTCTAATGCTTTGGGCTGG
Sequence Type mRNA
Unitrap ID UNI5320

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88145773..88149413 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001415 (Smg5) NM_178246 Smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2447364]

 
Come back to gene ENSMUSG00000001415


For any suggestions or comments, please send an email to unitrap@crg.es