Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST197428
Clone ID OST197428
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST197428
Sequence
ACTGAATATTGACATTTTTGNTTCAAGTTATGTTTTTAACATTTATTTCAGAACAATAAAGATTCAGATTTGTGACAAAG
AAAAAAA
Sequence Type mRNA
Unitrap ID UNI25045

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7206950..7207029 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032002 (Dcun1d5) NM_029775 DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1924113]

 
Come back to gene ENSMUSG00000032002


For any suggestions or comments, please send an email to unitrap@crg.es