Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSA151
Clone ID CSA151
Vector pGT0Lxf
Project baygenomics

Sequence tag CSA151
Sequence
GAGTGTGACCAGGTGAGGGTCCATACACTCTCCCAGCATGCCGTGCAGCCCAAGTACAGGTGCCCACTCTGCCAGGAGCA
GCTGGTGGGCCGGCCTGCCTTGCACTTCCACCTCAGCCACCTTCACAATGTGGTGCCCGAGTGCGTCGAGAAACTGTTGC
TTGTGGCCACAACTGTAGAGATGACCTTCGCA
Sequence Type mRNA
Unitrap ID UNI6459

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55686422..55687109 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040721 (Zfhx2) NM_001039198 zinc finger homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:2686934]

 
Come back to gene ENSMUSG00000040721


For any suggestions or comments, please send an email to unitrap@crg.es