Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AY0701
Clone ID AY0701
Vector pGT0lxr
Project sanger

Sequence tag AY0701
Sequence
TCAGGACTCTGTCTAAGACCAGCCTGTCTCCACCCTCACTGCCTGGACCTTTACTGTCGAGTCGCGTCCACCCGCGAGCA
CAGCTTCTTTGCAGCTCCTTCGTTGCCGGTCCACACCCGCCACCAGTTCGCCATGGATGACGATATCGCTGCGCTGGTCG
TCGACAACGGCTCCGGCATGTGCAAAGCCGGCTTCGCGGGCGACGATGCTCCCCGGGCTGTATTCCCCTCCATCGTGGGC
CGCCCTAGGCACCAGGGTGTGATGGTGGGAATGGGTCAGAAGGACTCCTATGTGGGTGACGAGGCCCAGAGCAAGAGAGG
TATCCTGACCCTGAAGTACCCCATTGAACATGGCATTGTTACCAACTGGGACGACATGGAGAAGATCTGGCACCACACCT
TCTACAATGAGCTGCGTGTGGCCCCTGAGGAGCACCCTGTGCTGCTCACCGAGGCCCCCCTGAACCCTAAGGCCAACCGT
GAAAAGATGACCCAGATCATGTTTGAGACCTTCAACACCCCAGCCAT
Sequence Type mRNA
Unitrap ID UNI610

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 143666430..144254188 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029580 (Actb) NM_007393 actin, beta Gene [Source:MGI Symbol;Acc:MGI:87904]

 
Come back to gene ENSMUSG00000029580


For any suggestions or comments, please send an email to unitrap@crg.es