Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST196869
Clone ID OST196869
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST196869
Sequence
GACTGAGGTTTATCATGGCTTCCAGCCCACCGTGTTGATGCGGCTGGTAGCTTCAGCATATTCTATCGCTCAAAAGGCAG
GAACCATAGTCAGGTGTGTCATTGCTGAAGGAGACCTGGGCATCGTGCAGAAGACCTCGGCCACCGACCTGCAGACCAAA
GCCGACCGCTTAGTGCAAATGAGCATATGCTCTTCCCTGGCCCGGAAGTTCCCGAAGCTGACCATCATAGGGGAAGAGGA
CCTGCCTCCTGGGGAAGTGGATCAAGAGCTGATTGAAGACGGGCAGTGGGAGGAGATCCTGAAGCAGCCGTGCCCCTCGC
AGTACAGTGCTATCAAGGAGGAAGACCTTGTGGTTTGGGTTGACCCCTTAGATGGCACCAAGGAGTACACTGAAGGTCTT
CTTGACAATGTAACAGTTCTCATTGGGATTGCTTATGAAGGAAAGGCCATCGCAGGCATCATNAACCAGCCGTATTACAA
CTACCAGG
Sequence Type mRNA
Unitrap ID UNI17567

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 187161983..187172715 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026617 (Bpnt1) NM_011794 bisphosphate 3'-nucleotidase 1 Gene [Source:MGI (curated);Acc:Bpnt1-001]

 
Come back to gene ENSMUSG00000026617


For any suggestions or comments, please send an email to unitrap@crg.es