Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHC439
Clone ID YHC439
Vector pGT0Lxf
Project baygenomics

Sequence tag YHC439
Sequence
GGAGACGTGGCTTGGGGCCGCCATCTTGGCAAGAGGCGAAGCGGCGGAGGCTCCTGTCAGGGGCGGCAGGTTCGGAGCGG
CCAGAGCTCCGCGTCTCTGGGCAGCAGCCCGAGTCCCCGCAGAGCCAGAGCGCGGCGCAGCGCGCCCCACCTGCGGCCTC
ACCAT
Sequence Type mRNA
Unitrap ID UNI1630

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44575754..44575918 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032096 (Arcn1) NM_145985 archain 1 Gene [Source:MGI (curated);Acc:Arcn1-001]

 
Come back to gene ENSMUSG00000032096


For any suggestions or comments, please send an email to unitrap@crg.es