Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST196798
Clone ID OST196798
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST196798
Sequence
CTGGGTCTTGGTTAAGCTTGGTGCTGGCNTANTTAGGGGTCTGTCTGGGGNGTACACTTGCTGTGGATAGANGCAACTTT
AAGANCTGTGATGAGANTTCCTTTTGCAAACGGCAGCGGAAGCATTCGGCCAGGCCTCTCTCCTTACCGTGCCTTGCTGG
ACACTCTGCAGCTTGGTCCTGATGCTCTTACAGTCCATCTGATCCATGAAGTCACCAAGGTCAGGCAAGACAAGAAAGAG
TGGTAGGGATGGGGAAATGGGTGGTAACTTGGGAAAGAAAAACTTGTAAATAAATGTCTTGTGTCAGGCTTAAAAAAAAA
AA
Sequence Type mRNA
Unitrap ID UNI19895

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8976753..8977213 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071650 (Ganab) NM_008060 alpha glucosidase 2 alpha neutral subunit Gene [Source:MGI Symbol;Acc:MGI:1097667]

 
Come back to gene ENSMUSG00000071650


For any suggestions or comments, please send an email to unitrap@crg.es