Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AY0684
Clone ID AY0684
Vector pGT0lxr
Project sanger

Sequence tag AY0684
Sequence
CCTTATCGGCTCGCACTTCATATCTCTCCTGCTTTGAGCATCCATCAGAGGTCCAGCATGAGTGCATCCCGCAGGCCATT
CTGGGGATGGATGTCCTGTGCCAGGCCAAGTCAGGCATGGGAAAAACAGCAGTGTTTGTCCTGGCCACACTGCAGCAGCT
GGAGCCCGTTACTGGGCAGGTGTCTGTGCTGGTGATGTGTCACACTAGGGAGCTGGCTTTTCAGATCAGCAAGGAATATG
AGCGCTTCTCTAAGTACATGCCGAATGTCAAG
Sequence Type mRNA
Unitrap ID UNI612

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35380375..35381493 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019432 (Bat1a) NM_019693 HLA-B-associated transcript 1A Gene [Source:MGI Symbol;Acc:MGI:99240]

 
Come back to gene ENSMUSG00000019432


For any suggestions or comments, please send an email to unitrap@crg.es