Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST195949
Clone ID OST195949
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST195949
Sequence
GACTGAGAGAAGGGAAGGGAAGGGAAGAGGAACGTAGAACTGAAGGCGGCCCTGGTCAAGTCCTCCTCCCGACTGCCCCT
GTCAGCAAGCAGCCTCAAGAGGGGTCCTGACCAGATGGAGGATGCCTTGGAGCCTGCAAAGAAACGGACACGAGTCATGG
GTGCAGTGACCAAAGTTGACACATCCCGTCCCAGAGGACCACCTCCTCAGCACAGTGTCACAGACCCAGGGCCACAATGC
AGACTNATNAGGAAAAGGGCATCTGATNCTANNACANCNATCTGTANNGAGATCTGANGCNCTTTTCTGGAGTGTNTNNA
GACAGCTACAGGGNNCTTACCTTTTATTATTTAAATAAATCTTTAAAGG
Sequence Type mRNA
Unitrap ID UNI23466

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27057738..27058556 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024301 (AC144621.3-201) NM_053173 kinesin family member C1 [Source:RefSeq peptide;Acc:NP_444403]

 
Come back to gene ENSMUSG00000024301


For any suggestions or comments, please send an email to unitrap@crg.es