Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSC032
Clone ID CSC032
Vector pGT0Lxf
Project baygenomics

Sequence tag CSC032
Sequence
CAGCCGCGCCTACAGAAACAGCATCAAGGATGCCCAGTCCCGCGTCCTGGGGGCCACGTCGTTTCGTCGCCGAGACCTGG
AACCGGGCACCCCCGCCA
Sequence Type mRNA
Unitrap ID UNI6486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93371175..93371272 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029381 (Shroom3) NM_001077595 shroom family member 3 Gene [Source:MGI Symbol;Acc:MGI:1351655]

 
Come back to gene ENSMUSG00000029381


For any suggestions or comments, please send an email to unitrap@crg.es