Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSC038
Clone ID CSC038
Vector pGT0Lxf
Project baygenomics

Sequence tag CSC038
Sequence
GCAAGCGCGTCGGGGCGGGCGCGTGAGCGGAGGCTTTGGCTGCAGGGGAAGGAGGACTATGAAGCTTCCGAATATCCTGC
TCACCGGTACACCAGGGGTTGGAAAAACCACACTAGGCAAAGAACTTGCATCAAGATCAGGCCTGAAGTACGTTAACGTG
GGAGATCTAGCTCGAGAAGGGCAGTTATACGACGGCTACGATGAGGAGTATGGCTGTCCCATTCTAGATGAGGATAGGGT
TGTCGATGAGTTAGAGCATCAGATGCAGGAGGGCGGTGTGATTGTGGATTACCACGGCTGTGACTTCTTCCCCGAACGCT
GGTTTCATATAGTGTTTGTGTTGAGAACAGATAATGGTGTATTGTATAAACGACTTGAAACA
Sequence Type mRNA
Unitrap ID UNI6487

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101421315..101434149 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078941 (4921516M08Rik) NM_027592 Adenylate kinase isoenzyme 6 (EC 2.7.4.3)(ATP-AMP transphosphorylase 6) [Source:UniProtKB/Swiss-Prot;Acc:Q8VCP8]

 
Come back to gene ENSMUSG00000078941


For any suggestions or comments, please send an email to unitrap@crg.es