Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST195687
Clone ID OST195687
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST195687
Sequence
CCCGCGGTCAGCAGCCCAGNANAGGCCCAAGGGATGAGGACACCACAGAGCGCTGTGACGCCCTCGCTGCAGGAGCCGGG
CCGAGCCTGACGTCTGTCCTCTCCACGTGCGCACCGGCCTCCGAGGGAGCGGCCGGCCAGTGGCTGCCGCATGGAACGTC
TGCAGAAGCAACCTCTTACCTCCCCGGGGAGCNGTCAGCCTCCTCCAGAGACTCCAGTGTGCCCGGCTCTCCCTCCAGCA
TCGTGGCCAAGATGGACAACCAGGTGTTGGGCTACAAGGATCTGGCTGCCATCCCCAAGGACAAGGCCATCCTGGACATT
GAGCGACCTGACCTCATGATCTATGAGCCCCACTTTACCTATTCCCTCCTGGAACATGTAGAGCTGCCCAGAAGCCGGGA
GTGCTCACTGTCACCCAAATCCACATCCCCCCCACCGTCTCCAGAGGTGTGGGCGGAGAGCCGGACTCTTGGAATNATCT
CTCAGGCTTCAACCCCAAGGACCACAGGGACCCCCAGGACCAGCCTGCCCCACTTCCACCACCCTGAGACTACCCGCCCG
T
Sequence Type mRNA
Unitrap ID UNI11419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71015084..71018212 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]

 
Come back to gene ENSMUSG00000022099


For any suggestions or comments, please send an email to unitrap@crg.es