Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSC069
Clone ID CSC069
Vector pGT0Lxf
Project baygenomics

Sequence tag CSC069
Sequence
GGCCGAGTTATTTGGACCCTTGTGGATTATCAAGGTTTACAAGTATGAGTTCCAGAAGCCCTCAGTCTGTTTCTGCTGCC
CCCAAACAGTGGAGCCAGAGGAT
Sequence Type mRNA
Unitrap ID UNI6492

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121278369..121278886 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046110 (Serinc4) NM_001025371 serine incorporator 4 Gene [Source:MGI (curated);Acc:Serinc4-001]

 
Come back to gene ENSMUSG00000046110


For any suggestions or comments, please send an email to unitrap@crg.es