Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST195422
Clone ID OST195422
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST195422
Sequence
GCTGGCAGAGGAACCCACCATGGATGGGGACTTCCCTCCACATGAGCTCCCACCCCCTGGAGGTGGCATCCAGCTACAGA
ACCGACTCCTGCACTGTCCTTGGTGGGGCAGTTTCTCACCGTCTTTGTACCCCACCTTCTCCAGTGAAAACCAACAGTTC
GTGGGTTCCACCCCATTCCTTGGTGGCCAGTCTTGCCCTGAAACCANCTACCCCACCACAGCCACCGTCCCCAGCTTNTT
CTCCAAGAGCAGCGACTTTCCTCAGGGAGGAGANGTAGTCTNCCCTCCCCCAGCCTGAAACNTGCTTGCTCGGGGNGGAG
NTTNCTGCTCATTCGTTCTNGCACGCCCACTGTTGGAACCTTGAGGAGCCACACACGNGCACCTTTCTACTGAACCAGAA
ATTATTCGGCGGGAATCGGGTCCCCT
Sequence Type mRNA
Unitrap ID UNI25092

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79545359..79549080 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035673 (Sbno2) NM_183426 strawberry notch homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2448490]

 
Come back to gene ENSMUSG00000035673


For any suggestions or comments, please send an email to unitrap@crg.es