Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST195407
Clone ID OST195407
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST195407
Sequence
TTTAAAGAAATAAGTTTTGCATATGAAGTATTGTCAAATCCAGAGAGGCGAGAGCTGTATGACAGATATGGAGAACAAGG
CCTACGGGAAGGCAGCGGCGGAGGCGGTGGAATGGATGATATCTTCTCACATATTTTTGGTGGAGGATTGTTTGGCTTTA
TGGGCAATCAGAGTAGAAGTCGAAATGGCAGAAGAAGAGGCGAGGACATGATGCATCCACTAAAAGTATCTTTAGAAGAC
CTGTACAATGGCAAGACAACCAAACTACAACTTAGCAAGAATGTGCTCTGTAGTG
Sequence Type mRNA
Unitrap ID UNI25093

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 88072791..88077309 220
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031701 (Dnaja2) NM_019794 DnaJ (Hsp40) homolog, subfamily A, member 2 Gene [Source:MGI Symbol;Acc:MGI:1931882]

 
Come back to gene ENSMUSG00000031701


For any suggestions or comments, please send an email to unitrap@crg.es