Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHC332
Clone ID YHC332
Vector pGT0Lxf
Project baygenomics

Sequence tag YHC332
Sequence
GTGGGTTTTCGTGAGGCGGTGGAGGCTTGCTTGAACGGGTCTCCTCAGCGGCGGCTGGAGTCGGTACGTCCTTGCCCGAG
CTCATCAGCCGAGGCGTCTGGCAGCAAACCCCAGCTCCAAAATTTGGAAATACTGCACATCTAGTTGGCTCCAAATTGTA
AACCACAGGATGAGTATTCAGTGGGCATGAGAGATTGAGAACATCCTACCACACCATAAACCTTGGTGTAGATCACTTCC
TTTTCTGTGGATTGAAGCCAGAGAGCACAATGAGTACAAGAAATCCTCAAAGAAAGCGGCGTGGTGGAACTGTGAATTCT
AGACAAACCCAGAAGCGAACTCGGGAAACAACTTCGACCCCTGAGGTTTCCTTGGAAACAGAACCCATAGAACTTGTGGA
AACTGTTGGAGATGAAATTGTGGACCTCACCTGTGAATCTTTAGAGCCCGTGGTTGTGGACCTGACTCACAATGACTCTG
TTGT
Sequence Type mRNA
Unitrap ID UNI6494

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34679071..34691391 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029110 (Rnf4) NP_035408 ring finger protein 4 Gene [Source:MGI Symbol;Acc:MGI:1201691]

 
Come back to gene ENSMUSG00000029110


For any suggestions or comments, please send an email to unitrap@crg.es