Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHC333
Clone ID YHC333
Vector pGT0Lxf
Project baygenomics

Sequence tag YHC333
Sequence
AAATATTATTTTCCTGGTGATCACGCTGTGCAAAATGGTGAAACATTCAAACACTTTGAAACCAGATTCTAGCAGGTTGG
AAAACATTAAGTCTTGGGTACTTGGCGCGTTCGCCCTGCTGTGTCTCCTGGGCCTCACCTGGTCCTTTGGGTTGCTTTTT
GTTAACGAGGAGACTGTTGTCATGGCGTATCTCTTCACCGCCTTTAATGCTTTCCAGGGACTCTTCATTTTCATCTTCCA
CTGTGCTCTTCAAAAGAAAGTACGAAAAGAGTATGGCAAGTGCTTCAGACACTGGTACTGCTGTGGCGGCCTCCCGACCG
AGAGCCCGCACAGCTCTGTGAAGGCATCCACCACCCGCACCAGTGCTCGGTACTCCTCTGGCACACAGAGCCGTATAAGA
AGGATGTGGAATGACACCGTGAGGAAGCAGTCTGAATCGTCTTTTATCTCAGGTGACATCAATAGCACTTCTACCCTTAA
CCA
Sequence Type mRNA
Unitrap ID UNI3134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 148485921..148491530 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028184 (Lphn2) NP_001074767 latrophilin 2 Gene [Source:MGI Symbol;Acc:MGI:2139714]

 
Come back to gene ENSMUSG00000028184


For any suggestions or comments, please send an email to unitrap@crg.es