Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHC339
Clone ID YHC339
Vector pGT0Lxf
Project baygenomics

Sequence tag YHC339
Sequence
AATCCAAATCTGAATATGAGCTGAGCATTCCTGACTCAGGTCGAAGCTGCTGGGGTGTTGGAGAGCTTGATGACAAGAGA
GCTCAGCAGAGGTTTCAGTTCAGTCTACAGGACTTCAGGTGCTGTGCTGTCTTGGGGAGAGGACACTTTGGAAAGGTGCT
GTTGGCGGAATATAAACACACAAATGAAATGTTTGCAATAAAAGCCTTAAAGAAAGGAGACATTGTGGCACGAGATGAAG
TAGACAGCCTGATGTGTGAAAAAAGAATTTTTGAGACTGTGAATAGTGTCAGGCACCCGTTTCTAGTGAACCTTTTTGCA
TGTTTCCAAACAAAAGAGCATGTTTGCTTCGTGATGGAGTATGCTGCAGGTGGTGACCTGATGATGCACATCCATACTGA
TGTCTTCTCTGAACCCAGAGCTGTATTTTATGCAGCATGTGTAGTTCTTGGGTTGCAATACTTACATGAACACAAAATTG
TTTATAGAGATTTGAAGTTGGATAACTTGTTGCTAGATACAGAAGGCTTTGTGAAAATTGCTGACTTTGGTCTTTGCAAA
GA
Sequence Type mRNA
Unitrap ID UNI6496

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 142462771..142472866 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004591 (Pkn2) NP_848769 protein kinase N2 Gene [Source:MGI Symbol;Acc:MGI:109211]

 
Come back to gene ENSMUSG00000004591


For any suggestions or comments, please send an email to unitrap@crg.es