Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHC342
Clone ID YHC342
Vector pGT0Lxf
Project baygenomics

Sequence tag YHC342
Sequence
CCAGAGGGACCCTAGCGTGCTTTCTGTAACGCCTGCCGTTACTCCTTCTACCCCGAGGCTGTCCTAAGAGGGCTCTCCTT
TGTCAGAAAAGATGAATGAAGCATAGTAGCTGTAGCATGAAGGGTTACAGTGTTGCGTGTTAAGGGATGAACCCCCAAAG
TGCCTGTAGAAAACAGCTCTGGGCCTAATGTCCTGGCTGCGGTGCAGGATGAAAGACTCCGGTTGATAGACCGCTACGGA
GAAAAACCAAAGAAGGCTGTCATGAGAACATCCTCGGGTGCAGGGGTCCATGGATGCCCAGAGACGAAGCTGCAAG
Sequence Type mRNA
Unitrap ID UNI6498

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 137429144..137429459 316
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019054 (Fis1) NM_025562 Friend virus integration site 1 Gene [Source:MGI (curated);Acc:Fis1-002]

 
Come back to gene ENSMUSG00000019054


For any suggestions or comments, please send an email to unitrap@crg.es