Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST195170
Clone ID OST195170
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST195170
Sequence
GACTGAGGATGGAAATGCAGGAACCANACATGAATGGAACCCTCTCTGCGGGTGCTGNTGCGGGCTACAGGCAGGAACGC
TNAAGGCTTNCTGCCCACCACCCGTANCCCTGCTACTTGGGAGGAAACCTGTCCAGTTCTTGGATTTCGAGGGGAAGACA
TCATTCGGAATGTCAGTGTTCAACCTCAGCAACGCTATCATGGGGAGTGGCATCCTGGGACTGGCTTATGCCATGGCACA
CACTGGAGTCATCTTCTTTTTGGCCCTGCTGCTGTGCATCGCTCTCCTGTCTTCTTACTCCATTCACCTCCTGCTGACCT
GTGCCAGTGTTGTAGGCATCCGTGCCTATGAGCAGCTGGGACAGAGGGCATTTGGACCTGCCGGGAAAGTAGTCGTGGCC
ATCATCATCTGTCTGCACAACGTTGGGGCTATGTCCAGTTACCTGTTCATCATCAAATCTGAACTCCCCCTTGTTATTGG
CACCTTCCTGCACATGGACCCTGAGGGAGACTGGTTCTTGAAGGGGAATCTCCTTATCATCCTGGTCAGCTTGTTTGCCA
Sequence Type mRNA
Unitrap ID UNI25099

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7849011..7853293 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031170 (Slc38a5) NP_766067 solute carrier family 38, member 5 Gene [Source:MGI (curated);Acc:Slc38a5-002]

 
Come back to gene ENSMUSG00000031170


For any suggestions or comments, please send an email to unitrap@crg.es