Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHC355
Clone ID YHC355
Vector pGT0Lxf
Project baygenomics

Sequence tag YHC355
Sequence
GCAGGACGGGGGGCGGGGGCGGCCACCTGGCCCGGACCACCCCGGCCCGCCGCGCCGTCAACAAAGTGGTGTACGATGAC
CACGAGAGTGACGACGACGACGAGGAGGAGGACATGGTCTCGGAGGAGGACGAGGAGGAGGAGGAGGATGGCGACGCCGA
GGAGACCCAGGATTCCGAGGACGAGGAGGAAGATGACATGGAAGAAGACGACGATGACTCCGATTATCCGGAGGAGATGG
AAGACGACGACGACGACGCTAGTTACTGCACGGAAAGCAGCTTCAGGAGCCATAGTACATACAGCAGCACT
Sequence Type mRNA
Unitrap ID UNI5381

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106992592..106992902 311
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040481 (Bptf) bromodomain PHD finger transcription factor Gene [Source:MGI (curated);Acc:Bptf-002]

 
Come back to gene ENSMUSG00000040481


For any suggestions or comments, please send an email to unitrap@crg.es