Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHC357
Clone ID YHC357
Vector pGT0Lxf
Project baygenomics

Sequence tag YHC357
Sequence
GGGGGGGATCCACCCCCACCCCACAGAGAAAGCACAATCTGTTTTGTGGGTGGGGTCTCAGGCGCCACCCCCTGAAGCAT
GGCCACCCCTGTGGTCACCAAGACAGCCTGGAAGTTGC
Sequence Type mRNA
Unitrap ID UNI6504

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 97606676..97606793 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031787 (Katnb1) NM_028805 katanin p80 (WD40-containing) subunit B 1 Gene [Source:MGI Symbol;Acc:MGI:1921437]

 
Come back to gene ENSMUSG00000031787


For any suggestions or comments, please send an email to unitrap@crg.es