Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST195077
Clone ID OST195077
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST195077
Sequence
GGGCTCCTGCGTGACCCTGGGCTCTGGTGGGCAATTGTGGATGCCTGTGTGATCACTGCAGGGGGTGCCAAGCTGCAGAN
AGCATTGAGCACCCCCACCGAGCCTGTGCAGAGAGCTGGCCCGTTACCAGATTTGCTCCTGGAACCACACCTGTCCTGAC
CCGGGAAGTGAGACCCCTGACCCTGGAACTTCTTGAGGAAACTGTGCAGGCCATGGAGGTGGAATGAAGTGGCCTGAGAT
GTAGAGTTTGGAATGAGGGTGAATAAATCCGGGAAACACAAACACTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108459626..108460005 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031897 (Psmb10) NM_013640 proteasome (prosome, macropain) subunit, beta type 10 Gene [Source:MGI Symbol;Acc:MGI:1096380]

 
Come back to gene ENSMUSG00000031897


For any suggestions or comments, please send an email to unitrap@crg.es