Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST194847
Clone ID OST194847
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST194847
Sequence
GGACGATGTAGACGTCNNTCCGGCGGCNGCCTGGGACGGCGNCTGCAGCGACNGTGTTAAAGCNGCTGGCTGCNCACTAC
CAGANGTCTAAGTTTNTGGAACTCAACCTTGCTCANAAAAAAAGGAGGCTGAAAGGTCAGNTTCCTGAAATTAAACAGAC
TTTGGAAATTCTGAAATACATGCAGAAGAAAAAAGAGTCTACCAATTCAATGGAGACGAGATTCTTACTGGCCGATAACC
TGTACTGCAAAGCTTCAGTCCCTCCTACTGATAAAGTATGCCTATGGTTGGGGGCTAATGTAATGCTTGAATATGATATT
GATGAAGCTCAGGCCTTGTTGGAAAAGAATTTATCAACTGCCACAAAGAATCTTGATTCTCTTGAAGAAGACCTTGACTT
TCTTCGAGATCAGTTTACTACCACAGAAGTCAATATGGCCAGGGTTTATAATTGGGATGTAAAACGAAGAAACAAAGATG
ATTCTACCAAGAATAAAGCATAACACTGGCNATTGAAAATGTGATTCAGG
Sequence Type mRNA
Unitrap ID UNI3561

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 72762427..72779344 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031197 (Vbp1) NM_011692 von Hippel-Lindau binding protein 1 Gene [Source:MGI (curated);Acc:Vbp1-001]

 
Come back to gene ENSMUSG00000031197


For any suggestions or comments, please send an email to unitrap@crg.es