Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST194644
Clone ID OST194644
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST194644
Sequence
GACTGAGGAAGCAGAATATGGTGGACATGATCAGTAAGATTTGTATGATGATGTCATCTCTCCATCTGCAAATAATGGCG
ATGCCCCAGAAGATCGCGGACTACATGGATACTCTTCCACCAACTGTTGGTGATGATGTG
Sequence Type mRNA
Unitrap ID UNI24008

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 116804913..116805049 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055531 (Cpsf6) NM_001013391 cleavage and polyadenylation specific factor 6 Gene [Source:MGI Symbol;Acc:MGI:1913948]

 
Come back to gene ENSMUSG00000055531


For any suggestions or comments, please send an email to unitrap@crg.es