Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST194628
Clone ID OST194628
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST194628
Sequence
ACAACATACTTTTGTTGAAACAGAGAGTGTAAGATATGTGTACCAACCTATGGAGAAACCTGTACATGGTATTGATCACT
ACAAAGAACAGCAATATCTTAGAAGATTTGGAGACTTTAAGGCTCTTCTCAAGGGTGATCCCTGAATATTGCCGAGCCTT
AGAGGAAAATGAAATATCTGAGCACTGTTTTGATTTGATTTTTGCTTTTGATGAAATTGTTGCCCTGGGATACCGGGAGA
ATGTTAACCTGGCACAGATCAGAACCTTCACAGAAATGGACTCTCACGAGGAGAAAGTATTCCGAGCAGTCAGAGAGACT
CAAGAACGTGAGGCTAAGGCTGAGATGCGGCGTAAAGCAAAGGAATTACAACAGGCCCGAA
Sequence Type mRNA
Unitrap ID UNI1630

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44566786..44568180 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032096 (Arcn1) NM_145985 archain 1 Gene [Source:MGI (curated);Acc:Arcn1-001]

 
Come back to gene ENSMUSG00000032096


For any suggestions or comments, please send an email to unitrap@crg.es