Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSC090
Clone ID CSC090
Vector pGT0Lxf
Project baygenomics

Sequence tag CSC090
Sequence
TCGTCTCCATGCGCCGGCTCCGGGGCGTAAAGCCTAGGCGCGAGGCTCAGACCACAGGTAGTGCGGACGCGGAGGGCCCT
GCCTGCCGGCCGTGAGCCGCGGCGTCCGCGGGACCAGCCCCAGCCAGCATGCTGCTCCTGCCGAGCGCCGCGGAGGGCCA
GGGCACCGCCATCACCCACGCTCTGACCTCCGCCTCTTCAGTCTGTCAAGTTGAACCTGTGGGAAGATGGTTTGAAGCTT
TTGTTAAGAGGAGAAACAGAAATGCTTCTACATCTTTTCAGGAACTGGAAGATAAGAAAGAGTTGTCAGAGGAATCAGAA
GATGAAGAGTTACAGTTAGAAGAATTCCCCATGCTGAAAACACTTGATCCCAAAGATTGGAAGAATCAAGATCATTATG
Sequence Type mRNA
Unitrap ID UNI6514

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 21287199..21290998 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029014 (Dnajc2) NM_009584 DnaJ (Hsp40) homolog, subfamily C, member 2 Gene [Source:MGI (curated);Acc:Dnajc2-006]

 
Come back to gene ENSMUSG00000029014


For any suggestions or comments, please send an email to unitrap@crg.es