Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST194490
Clone ID OST194490
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST194490
Sequence
GACTGAGGCCCTCCCAAGCCTGGAGTCATTAAGTGGTTCTGCCTGTTCCAAGGGCGGAGCAGAAGCAGGCCGTGGTCCTG
CCAAGCGGATGTCCTGATTCCCTATTCTGACTCTAGAGAAGACTCCATCACAGATTGCTGCAATGTCTGTATCTAATCTA
TCATGGTTGAAGAAAAAGGCCCAGTCAGTGGATATTACTGCTCCAGGGTTCAACCCTTTAGGTGGTGCAGGGAAGCAAGC
ACCACAAGCCAGCAAGCCCCCGGCACCCAAGACCCCCATCATCGAAGAAGAACAGAACAACTCAGCAAACACCCAGAAGC
ATCCTTCCAGAAAAAGTGAACTGAAGAGGTTCTATACCATTGCTNACCTCCATGCACTGGCNTCCAAGACTAATTCCANA
NACTGCTGCTGATTCTAGCAAGTNCATCANCTGGCAGGNCCCGTTNCGGCCCTTCNGNCATAAGAGCATTTGCTAAATAA
GAGCCCNGAATAACCAGATCAATTAAAGTACA
Sequence Type mRNA
Unitrap ID UNI22868

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 41367114..41538293 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022307 (Oxr1) NM_130885 oxidation resistance 1 Gene [Source:MGI Symbol;Acc:MGI:2179326]

 
Come back to gene ENSMUSG00000022307


For any suggestions or comments, please send an email to unitrap@crg.es