Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST194455
Clone ID OST194455
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST194455
Sequence
AGCTTCCAGCTTGAGATAAGTGGGTTTTTAAAAGANATGGCCTGTCCATACTCGGTACTCGTCTCAGGAGACATTAAAGA
GCGCCTCACAAAGAAGGATGACTGCTTGAAACTTCTGTTGNTTTTAAGTACAGAACTTCAAGCTTTAC
Sequence Type mRNA
Unitrap ID UNI25126

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 117084974..117085940 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027349 (2610510H03Rik) NM_026620 RIKEN cDNA 2610510H03 gene Gene [Source:MGI Symbol;Acc:MGI:1915465]

 
Come back to gene ENSMUSG00000027349


For any suggestions or comments, please send an email to unitrap@crg.es