Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSC117
Clone ID CSC117
Vector pGT0Lxf
Project baygenomics

Sequence tag CSC117
Sequence
GGTGTGGGGCGCGCTACTCCGGAGGTAGAATCTGCGGCTCCTTGCTGGAGGGGCTGCCGGCTTTCTTGCTTCCTCTGCTG
CACCGTGTGCTCAAGCCTCGAGACTTGGCTAGCAGCATTGGTCCACACGGCTGCTATAGCTGCTTCCAATGGCTGGCAAT
AAAGGAAGAGGGCGTGCTGCCTACACCTTTAATATCGAAGCTGTTGGATTCAGCAGAGGGGAGAAGTTACCTGATGTTGT
GTTGAAGCCTCCACCCCTGTTTCCTGATACAGACTACAAGCCGGTGCCCCTGAAAACGGGAGAAGATGAGGATTACATGC
TGGCCTTGAAGCAGGAGTTGAGGGAAACAGTGAAACGATTGCCGTACTTTATTGAACCACCCGAAGAAAAACAAGATGAT
ATTGAAAGGTATAGCAAACGATACATGAAGGTCTATAAAGAAGAATGGGTACCAGATTGGAGAAGACTTCCAAGAGAGAT
GATGCCAAGGAAAAAATGCAAAAA
Sequence Type mRNA
Unitrap ID UNI6516

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 81826127..81849971 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035834 (Polr3g) NM_001081176 polymerase (RNA) III (DNA directed) polypeptide G Gene [Source:MGI Symbol;Acc:MGI:1914736]

 
Come back to gene ENSMUSG00000035834


For any suggestions or comments, please send an email to unitrap@crg.es