Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST194298
Clone ID OST194298
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST194298
Sequence
GACTGAGGTCTTGTTGCAGCATCTGGCAGTGACTCTGAGGATGAAGACAGCATGGACAGTCCCCTGGACCTTTCCTCATC
AGCAGCCTCTGGCAAGAGAAGGAGGAGAGGCAATCTGCCCAAGGAGTCAGTCCAGATTCTGCAGAGACTGGCTGTATGAA
CACAGATACAACGCCTATCCCTCAGAGCAAGAGAAAGCACTGCTGTCCCAGCANACACACCTGTCCACACTACAGGTNTG
TNACTGGTTCATNAACGCCCGCCGCAGGCTCCTTCCTGACATGCTGAGAAAGGATGGCAAAGATCCAAATCAGTTCACGA
TTTCCCGCCGTGGGGCCAAGATTTCAGAAGCTAGCTCTATTGAAGCTGCAATGGGTATCAAAAACTTCATGCCAACTCTA
GAAGAGAGCCCATTTCATTCCTGCGTAGTTGGACCCAACCCAACCCTAGGGAGACCAGTGTCTCCCAAACCTCCCTCCCC
AGGATCCATTTTGGCTCGCCCGTCAGTGATCTGCCATACCACTGTGACTGCATTGAAGGATGGGCCTTAAAGGCCCT
Sequence Type mRNA
Unitrap ID UNI16533

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71194300..71195743 310
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047407 (Tgif1) NM_009372 TGFB-induced factor homeobox 1 Gene [Source:MGI (curated);Acc:Tgif1-003]

 
Come back to gene ENSMUSG00000047407


For any suggestions or comments, please send an email to unitrap@crg.es