Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST194246
Clone ID OST194246
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST194246
Sequence
GACTGAGATTCTCTGTGAGCCGCACCTTCTGGTACACTGATCTCCCGGGGGGCCATCCGCCCGACTGCCCCTGACTCCGG
CAGCGGGGACCCCCCATGGCAGTGGGCACCTCCCCTTGAAACCTGCCANGCTGGACGCCACAGCCCTGCACGACGACACC
TCGGCCAGCTCCACGCCCATCTCTGAGGCTTGCAGCCATGCGGTCCTCGCCTGCGGCCCGGGCATCCCTGAAGAGTACTA
TGTGAGCNAGGCNTGTGGAAGATGCTCCCAGCTACAGANAGCACCGGGATGCCTGCACCATCACCNACNTTGTGCAACAG
CACCAACCTTTCAGAAGNTGAGATCATNTAGCCCTGCTGGAGGAACAGNTGCCCCATTACAAGCTAAGAGCGGACACCAT
CTATGGTTACGACCACGATGACTGGCTGCNATACGGCCCCTCATNTCCNCAGATGCCAACATCCGACCTCACANCTGAGC
AGATCGAAGAGACGCNTGAAAAAACTTCCTTTTATTNTGCCGAAAGAGTTGGCCAGATG
Sequence Type mRNA
Unitrap ID UNI14300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121273117..121340625 287
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032536 (Trak1) NM_175114 trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]

 
Come back to gene ENSMUSG00000032536


For any suggestions or comments, please send an email to unitrap@crg.es