Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST194244
Clone ID OST194244
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST194244
Sequence
GACTGAGACCCCCGTCAGAGGATGAAGGAATGGATATCCACTTCGAGGAGGGAGTGCTGAGTCCCAGTGCCGCAGACATG
AGGCCCGAACCTCCCAATTCTCTGGATCTCAATGGCAGTCACCCTAGAAGAATCAAGCTCACAGCCCCAAATATCAACCT
CTCTCTGGACCAAAGTGAAGGATCTATTCTCTCTGATGATAACCTAGACAGTCCGGATGAGATTGACATCAATGTGGATG
AACTCGATACCCCTGATGAAGCAGACTCTTTTGAATACACTAACCATGAAGATCCCACGGCCAACAAAAGCTCTGGTCAA
GAGTCAGAGTCTATTCCAGAATATACGGCTGAAGAGGAGCGAGAAGACAACCGGCTGTGGAGGACGGTGGTCATCGGGGA
GCAGGAGCAACGGATTGACATGAAGGTCATTGAACCCTACAGGAGAGTCATTTCTCACGGAGGATACTATGGGGACGGTC
TGAATGCCATGATTGGGGTTGCTGCCTGNTTTCTGCCAGACAGCA
Sequence Type mRNA
Unitrap ID UNI13002

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 17242751..17273665 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039126 (A230083H22Rik) BNIP2 motif-containing molecule at the C-terminal region 1 [Source:UniProtKB/Swiss-Prot;Acc:Q52KR3]

 
Come back to gene ENSMUSG00000039126


For any suggestions or comments, please send an email to unitrap@crg.es