Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST194105
Clone ID OST194105
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST194105
Sequence
GACTGAGGTTATTCAGCTCCTTAAAGCTGGGAAAGCCAAGGAAGTCTCCTACAATGCCCTGGCCTCACACATCATTTCAG
AGGATGGGGACAACCCAGAGGTGGGAGAAGCCCGTGAGGTCTTTGACTTGCCCGTTGTAAAGGTAAGTAGAAACCTGAGC
CTCTGCACCAGGGCTTTCTGCCTGGCTTGCTGCAGGCCAGTGTTAAGTAGGATATCATCAGGTAAACAAAGCCCATAAAC
TTTAGTCACCTGCCTTCACTTTGGGACTTGCTGGCCAGATGGCTCAGTGGGTAAGAACACTGACTGCTCTTCCAAAGGTC
CTGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCACCTGTAATGAGATCTGACACCCTCTTCTGGTGCGTCTGA
AATCAGCTACAGTGTACTTATGTATAATAATAAATAAATCCTTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI8655

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 28114871..28115322 448
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002221 (Paxip1) NM_018878 PAX interacting (with transcription-activation domain) protein 1 Gene [Source:MGI Symbol;Acc:MGI:1890430]

 
Come back to gene ENSMUSG00000002221


For any suggestions or comments, please send an email to unitrap@crg.es