Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST193935
Clone ID OST193935
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST193935
Sequence
CTTGCTCTTGGTGGCGTACTTCGGGCTGANCAGCAAATTAAAGCGAATTTACCGCNGCGGTAAAAGCTCANATTCACAGC
TGCATAAGTCGCCACCTGGAATGCCTTCGGAGCCGAGAGGTGTGAAAAAAAAAGAA
Sequence Type mRNA
Unitrap ID UNI25148

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32984032..32985553 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056234 (AC154532.3-202) NP_001029160 nuclear receptor coactivator 4 [Source:RefSeq peptide;Acc:NP_001029160]

 
Come back to gene ENSMUSG00000056234


For any suggestions or comments, please send an email to unitrap@crg.es